JEQ Journal of Natural Resources and Life Sciences Education
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Quilbé, R.
Right arrow Articles by Oudinet, J.-P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Quilbé, R.
Right arrow Articles by Oudinet, J.-P.
Agricola
Right arrow Articles by Quilbé, R.
Right arrow Articles by Oudinet, J.-P.
Related Collections
Right arrow Runoff
Right arrow Heavy Metals
Right arrow Experiment Design
Right arrow Cell Biology & Molecular Genetics
Right arrow Water Pollution
Published in J. Environ. Qual. 33:149-153 (2004).
© ASA, CSSA, SSSA
677 S. Segoe Rd., Madison, WI 53711 USA

TECHNICAL REPORTS

Heavy Metals in the Environment

Combinatory Chemical and Biological Approaches to Investigate Metal Elements in Agricultural Runoff Water

Renaud Quilbé*,a,b, Isabelle Pieria, Stanislas Wichereka, Nathalie Dugasc, Albert Tasteyrec, Yolène Thomasa and Jean-Paul Oudineta

a Centre de Biogéographie-Ecologie, FRE 2545 CNRS/ENS-LSH, 15 Parvis René Descartes, 69366 Lyon cedex 07, France
b INRS–Eau, Terre & Environnement, Université du Québec, 2800 rue Einstein, C.P. 7500, Sainte-Foy (Québec), G1V 4C7, Canada
c Vigicell, Institut André Lwoff, Bât. G, 7 rue Guy Moquet, 94801 Villejuif, France

* Corresponding author (renaud_quilbe{at}inrs-ete.uquebec.ca).

Received for publication August 1, 2002.

    ABSTRACT
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
As part of a project studying the interactions between farming practices, soil erosion processes, and fate of agricultural pollutants into runoff waters, we conducted a pilot study to investigate the relationship between metal contents and metallothionein-2A (MT-2A) as a bioindicator of metal exposure. Runoff water samples were collected between May and November 1999 at the point of outlet of an elementary watershed located in the Paris basin. Selected metals (Al, As, Cd, Cr, Cu, Pb, Hg, Ni, and Zn) were analyzed using conventional techniques. In parallel, human T cells were exposed to water samples for 6 and 18 h and then cell viability and MT-2A gene expression were measured. Results show that among the 10 water samples tested, Al and Zn predominate (highest values = 4.9 and 2.6 µM, respectively), while other metals were below the µM level. Five out of 10 samples induced MT-2A gene expression (30–80% increase at 18 h) as compared with the control. When comparing MT-2A induction profile with metals contents, no obvious correlation was found, suggesting that additional components or parameters are involved. Finally, there was an apparent inverse relationship between Ca concentration and MT-2A gene induction. Although still preliminary, in the absence of longer monitoring, this study shows that MT-2A gene expression is a useful tool to complement chemical analysis in assessing metal elements in water. These combinatory approaches will be pursued and integrated in an ongoing watershed field research project.

Abbreviations: GaPDH, glyceraldehyde-3'-phosphate dehydrogenase • ICP–OES, inductively coupled plasma–optical emission spectrometry • MT-2A, metallothionein-2A • PCR, polymerase chain reaction • RT, reverse transcriptase


    INTRODUCTION
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
ENVIRONMENTAL POLLUTION ORIGINATES mainly from industrial processes as well as farming practices. Agriculture affects water quality mainly through the movement of sediments, nutrients, and nonbiocompatible substances by water runoff and leaching into ground water or tile drains (Cooper, 1993; Fenelon and Moore, 1998). Although a number of approaches have been introduced for monitoring water quality, none of them are entirely satisfactory. Indeed, conventional chemical analyses of detectable pollutants measure water characteristics but do not provide information on the biological effect of chemicals. Therefore, additional models of pollutant impact integrating chemical and biological approaches have to be considered. Until now, most experimental procedures have been confined to laboratory tests performed on organisms or cells exposed to a single pollutant (Beyersmann and Hechtenberg, 1997; Bierkens, 2000). However, in real life, biological effects are mainly influenced by chemical mixtures. Further, natural factors such as organic matter or Ca that could modulate contaminant effects are rarely studied (Christensen et al., 1996; Larison et al., 2000). In this regard, the integration of biochemical and molecular biological markers in field studies may be useful to understand the effects of combinations of compounds like additive, synergistic, or antagonistic interactions. Biological assays include measurements of stress protein expression at the level of whole organism such as fish or molluscs living within polluted areas (Luoma, 1995; Langston and Bebianno, 1998; Cajaraville et al., 2000; de Lafontaine et al., 2000). Nevertheless, many reasons such as inter-individual variability of biological signal and the physiological variations of stress proteins unrelated to the effects of any environmental stress factor may limit the routine use of such methods. An alternative approach is the measurement of stress proteins under controlled conditions such as from cultured cells exposed to field samples.

Since 1994, our laboratory has been involved in field research in Picardy, an intensively farmed region of the Paris basin (France). Investigations study the relationships between farming practices, soil erosion processes, and fate of agricultural pollutants into runoff water (Mabit and Bernard, 1998; Angéliaume and Wicherek, 2002; Quilbé et al., 2002). For this study, we focused on a small elementary watershed on which sewage sludge rich in metals has been used as a soil amendment for several years. To our knowledge, few if any studies have investigated the transfer of dissolved metals from sludge-treated soils via runoff into surface waters and the biological impact. The year 1999 was characterized by a majority of low covering crops on the watershed and intense precipitation leading to frequent runoff events. These considerations led us to collect runoff water to investigate metal contents and biological consequences using metallothionein (MT) as a molecular probe of environmental stressors.

In previous work, we have shown that metal elements, in particular Cd, activate in a time- and dose-dependent manner transcription of MT gene in human cells from the immune system (Pellegrini et al., 1994a, 1994b; Quilbé et al., 2000). Metallothioneins are a group of ubiquitous, cystein-rich, metal-binding proteins of low molecular weight. They are involved in maintaining the homeostasis of essential metals (Zn and Cu) as well as in sequestration and detoxification of toxic metals such as Cd and Hg (Hamer, 1986; Klaassen et al., 1999). Accordingly, MTs offer considerable potential as a biochemical indicator of metal exposure (Sanders, 1990). There are several MT genes differentially inducible by various metals across species and tissues. Among the MT-2 family, only the MT-2A gene is functional and metal-inducible (Karin and Richards, 1982).


    MATERIALS AND METHODS
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
Reagents
Ultrapure water, RPMI-1640 liquid or powder medium, and heat-inactivated fetal calf serum were obtained from Seromed Biochrom KG (Berlin, Germany). Cadmium chloride (CdCl2) was obtained from Sigma (St. Louis, MO), dissolved in ultrapure water at 10 mM, filtered, and stored at 4°C. RNase-free water was obtained from Baxter S.A. (Lessines, Belgium). Trypan blue, first strand buffer 5X (250 mM Tris-HCl; pH = 8.3; 375 mM KCl; 15 mM MgCl2), DTT, dNTP, M-MLV reverse transcriptase (RT)–polymerase chain reaction (PCR) buffer 10X (100 mM Tris-HCl pH 8.3), Taq DNA polymerase, and low molecular weight DNA ladder were obtained from Life Technologie Gibco BRL (Gaithersburg, MD). Oligo-(dT)12-18 and HPRI (human placenta RNase inhibitor) were obtained from Boehringer Mannheim (Germany), and [{alpha}-32P]-dCTP was obtained from Amersham Pharmacia Biotech (Little Chalfont, UK).

Primer Sequences
Gene-specific primers for amplification of MT-2A and glyceraldehyde-3'-phosphate dehydrogenase (GaPDH) were chosen from sequences in Genbank and synthesized by Eurobio (Les Ulis, France). The sequence for MT-2A was sense 5'TTCTTTACATCTGGGAGC3', anti-sense 5'ACCTCCTGCAAGAAAAGC3'; and for GaPDH, sense 5'TGTTCCGTTTCCAGCCCCCAA3', anti-sense 5'GGGCTTGTCTCCGTCGTTGAT3'. These intron-spanning primer pairs result in an additional 1895 (GaPDH) or 203 (MT-2A) base-pair fragments if genomic DNA is present in the RNA preparation.

Water Sampling and Physicochemical Analysis
The study area is an agricultural elementary watershed of 20 ha located at Erlon in the northern Paris basin (Picardy, France). Morphological, pedological, and climatological characteristics of the watershed, as well as measurement equipment, have been previously described (Angéliaume et al., 1994; Angéliaume and Wicherek, 2002). For each runoff event, water samples were collected at a gauging station installed at the point of outlet of the watershed and samplings were done between May and November 1999 depending on the hydrological conditions. Water samples were collected in autoclaved glass bottles. Measurements of physical parameters such as pH, temperature, conductivity, and dissolved oxygen were performed in situ using a multiparametric system (Multiline P4; WTW Measurement Systems, Ft. Myers, FL). Samples were placed at 4°C, protected from light, and filtered (0.45-µm Nalgene filter; Nalge Nunc Int., Rochester, NY) within 24 h. The same parameters were measured in the laboratory on filtered water and no major change was observed as compared with in situ measurements. Typically, the waters average a pH of approximately 7.9 (range of 7.1–8.3). Beside these widely used parameters, the following determinations were also performed: solid material, dissolved organic C, nitrates, ammonium, P, and chlorides (data not shown). For metals determination, a fraction of water samples was acidified by addition of 1% (v/v) concentrated HNO3. Selected analyzed elements were Al, As, Cd, Cu, Cr, Hg, Ni, Pb, and Zn, as well as Ca. Determinations were performed in duplicate (absolute error was always less than 10% of the mean) at the Institut de Recherche et de Développement en Agroenvironnement (IRDA, Sainte-Foy, QC, Canada) using inductively coupled plasma–optical emission spectrometry (ICP–OES) (Model ICAP; PerkinElmer, Boston, MA). Samples were maintained at 4°C during storage and transport to Canada in refrigerated box. Of note, to check for sample integrity during transport, some measurements had been previously performed both in Canada and in a French laboratory, resulting in low differences in metal concentrations (less than 30% of the mean, data not shown). Detection limits were 0.19 µM for Al, 0.04 µM for Cr, 0.03 µM for As, Cu, Ni, and Zn, 0.02 µM for Cd, and 0.01 µM for Hg and Pb.

Cell Culture
As previously described (Pellegrini et al., 1994b), for continuous cultures, CEM-C12, a human T cell line, was seeded at 3 x 105 cells mL–1 at 37°C in a humidified atmosphere containing 5% CO2, and aliquots were recultured at the same concentration in fresh medium, three times a week. The final medium consisted of RPMI-1640 with 100 U mL–1 penicillin, 100 µg mL–1 streptomycin, 2 mM glutamine, and 20 mM HEPES buffer, supplemented with 5% fetal calf serum (FCS). To examine the effect of water samples, cells were harvested in exponential growth phase and seeded at 6 x 105 cells mL–1 in final medium supplemented with 2% FCS for 24 h. Then, cells were centrifuged (100 x g, 6 min) and resuspended at 1.5 x 106 cells mL–1 in a 2% FCS culture medium (RPMI 1640 powder) reconstituted with the water samples (not concentrated) or ultrapure water as a control. The pH of final medium containing antibiotics, glutamine, and HEPES buffer was maintained at 7.4. After 6 or 18 h of culture, cells were analyzed for MT-2A gene expression. As a positive control, cells were cultured with 5 µM CdCl2 or vehicle. This concentration was chosen since we found, as previously described (Pellegrini et al., 1994a), that 5 µM CdCl2 induces maximal MT-2A gene expression in CEM-C12 cells. In addition, cell count and viability were performed by Trypan blue exclusion on all cell cultures at the time of the assay.

Reverse Transcriptase–Polymerase Chain Reaction Analysis
Total RNA was isolated by using QIA shredder cell lysate homogenizer and the Rneasy total RNA kit, according to the manufacturer's protocol (Qiagen, Germany). The RNA was resuspended in 20 µL of RNase-free water and the concentration measured at 260 nm. Reverse transcription reaction was then performed for 1 h at 42°C on 6 µg of total RNA in a 20-µL reaction volume containing 1st strand buffer, 10 mM DTT, 0.5 mM dNTP mix, 0.5 µg oligo-(dT)12-18, 200 U M-MLV RT, and 40 U HPRI. Inactivation of RT was obtained by heating the samples for 5 min at 95°C. The cDNAs were precipitated in 0.1 M NaCl 70% EtOH solution and resuspended in water, and concentrations measured at 260 nm. Amplification by PCR of MT-2A and GaPDH was performed separately; the latter (housekeeping gene) served as an internal standard for normalization of MT-2A mRNA level. Three-hundred nanograms of cDNA, 0.5 mM dNTP mix, 2.5 U Taq DNA polymerase, 2 mM MgCl2, primers for MT-2A (1.2 pmol µL–1) or GaPDH (0.4 pmol µL–1), and 1 µCi of [{alpha}-32P]-dCTP were added to PCR buffer in a final volume of 50 µL. The PCR reaction was performed using a thermal cycler (Mastercycler, Eppendorf, Germany) with an initial denaturation step of 5 min at 94°C, followed by 22 (MT-2A) or 26 (GapDH) cycles of a three-step program (1 min at 94°C, 1 min at 58°C, and 1 min at 72°C). The optimum number of cycles to stay in the linear range for the amplification of both cDNAs was determined before analyzing water samples. A final extension step was performed at 72°C for 5 min. The PCR products (15 µL) were then electrophoresed on 1% agarose gel, along with a 100 base pair DNA ladder. The gel was dried and quantification of PCR products was done by measuring the amount of 32P radiolabeled nucleotide (cpm) incorporated into amplified fragments using a Packard Instant Imager (PerkinElmer). Only expected bands of 141 bp (MT-2A) and 258 bp (GaPDH) were detected and used for quantification. The MT-2A gene expression was evaluated by the signal ratio of cpm values for MT-2A on the respective cpm values for GaPDH. The RT–PCR analysis was done in triplicate (standard deviation was always less than 15% of the mean). Results are expressed as fold of induction over control (signal ratio from cells cultured with tested water sample to signal ratio from cells cultured with ultrapure water).


    RESULTS AND DISCUSSION
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
We first investigated whether metals can be transferred from sludge-treated soils into surface waters on a farmed elementary watershed located in the Paris basin. Runoff water samples were collected during 1999 and tested for the presence of dissolved metal elements using ICP–OES. Selected metals were those commonly found in the watershed area. Table 1 summarizes salient characteristics of the 10 water samples used for the biological assay. Among the waters tested, Al and Zn predominate. Other elements were below the µM level or the limit of detection of the assay. The highest metal concentration was found in Sample 5 (4.9 µM Al). Intermediate levels were found in Samples 2, 3, 6, and 8 for Al (average of 2.8 µM) or Zn (average of 2.6 µM). With respect to the sampling period, the highest values of Al and Zn (Samples 2, 3, 5, and 6) were related to intense runoff events. It should be emphasized, however, that little significance should be attached to this observation in the absence of long-term monitoring data. The overall low level of metals found in the water samples may be due to the fact that analysis performed on filtered water measured only dissolved metals. We obtained preliminary evidence that the majority of crude water samples (nonfiltered) had overall higher concentrations of metal (around 200-fold) than the filtered ones.


View this table:
[in this window]
[in a new window]
 
Table 1. Metal elements and Ca concentration in water samples.

 
In the next set of experiments, CEM-C12 cells (a human T cell line) were incubated in medium reconstituted with either water samples or ultrapure water as a control. As a positive control, 5 µM CdCl2 was used. After 6 or 18 h, RNA was isolated and subjected to RT–PCR. At 6 h, only CdCl2 (5 µM) induced MT-2A gene expression (Fig. 1A) . By contrast, at 18 h, MT-2A gene expression displayed a strikingly different pattern (Fig. 1B, 1C): 5 µM CdCl2 as well as 5 out of the 10 water samples induced MT-2A gene expression as compared with the control ultrapure water. Levels of MT-2A gene expression increased from 30 to 80% for Samples 4, 5, 7, 8, and 9. Absence of MT-2A gene induction in some water samples was not due to nonspecific cytotoxic effect since the yield of viable cells was similar at the end of all cell cultures as measured by Trypan blue exclusion. Additional experiments showed that exposing cells to CdCl2 (5 µM) resulted in a MT-2A gene expression increase of 195 ± 8% (mean ± SEM, n = 8, p < 0.001, Student t test) as compared with cells exposed to vehicle. Exposing cells to ultrapure water resulted in a 2.1 ± 0.8% change, not significantly different.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 1. Metallothionein-2A (MT-2A) gene expression by CEM-C12 cells exposed to water samples. Cells were incubated (1.5 x 106 cells mL–1) for (A) 6 and (B) 18 h in medium reconstituted with either water samples (1–10) or ultrapure water as control (C) as described in the Materials and Methods section. Cadmium chloride (5 µM) was used as a positive control (Cd). Total cellular RNA was extracted and subjected to reverse transcriptase–polymerase chain reaction (RT–PCR) analysis. As described in the Material and Methods section, [{alpha}-32P]-dCTP was added to the PCR mixture and quantification of PCR products was done by measuring the amount of 32P-radiolabeled nucleotide (cpm) incorporated into amplified fragments. The 32P-labeled bands of PCR products corresponding to MT-2A and glyceraldehyde-3'-phosphate dehydrogenase (GaPDH; housekeeping gene) are presented. (C) For 18 h of exposure, MT-2A gene expression was evaluated by the signal ratio of cpm values for MT-2A on respective cpm values for GaPDH. The RT–PCR analysis was performed in triplicate (standard deviation was always less than 15% of the mean). Results are expressed as fold of induction over control (signal ratio from cells cultured with water sample to signal ratio from cells cultured with ultrapure water).

 
When comparing metal concentrations in the different water samples with the MT-2A gene expression profile, no obvious pattern emerged. For instance, Samples 5 and 8 (containing 4.9 µM Al and 1.3 µM Al + 2.6 µM Zn, respectively) induced MT-2A gene expression. By contrast, in Samples 7 and 9, even though metal elements including Al and Zn were barely detectable, MT-2A response was also observed. Further, Samples 2, 3, and 6, which display some of the highest metal contents, did not induce MT-2A gene expression. Surprisingly, among two samples (6 and 8) with an almost similar metal pattern (average of 1.5 µM Al and 2.6 µM Zn), only Sample 8 induced MT-2A gene expression. Correlation coefficients between metal concentrations and MT-2A gene expression were calculated and found to be less than 0.2 in absolute value. In addition, when considering the sum of As, Cd, Cu, Hg, and Zn concentrations (five well-known inducers of MT-2A), no correlation was found (r = –0.21).

Taken together, these observations suggest that other elements, parameters, and/or processes are involved in the modulation of MT-2A gene induction. Although this point cannot be resolved at the present time, a number of alternative possibilities can be envisioned. First, the data may reflect the presence in Samples 7 and 9 of additional pollutants not assessed here or metals present in concentrations below the minimum detectable level by the ICP–OES assay. Indeed, it has been shown that concentrations of dissolved metals not detectable by conventional procedures may induce biological response. For instance, exposure to 10–14 M of Pb activates brain protein kinase C, a protein that plays a key role in the control of cellular signal transduction (Markovac and Goldstein, 1988). Second, different metal speciation depending on the water samples may affect their bioavailability. This seems unlikely, however, since dissolved organic carbon content (range of 11.6–103.6 mg L–1), a well-known metal complexing agent (Christensen et al., 1996), was not related to the expression of MT-2A assayed in the corresponding water samples (not shown). Moreover, it should be pointed out that RPMI medium components such as fetal calf serum may modify metal speciation so that metal concentrations available for cells in complete media may not be fully equivalent to the real concentrations measured in water samples. Third, complex interactions between metals can act additively, synergistically, or antagonistically. Along this line are recent studies showing that mixtures of metals at low concentration can act together to induce biological response, although none of the metals alone do so (Mutwakil et al., 1997). Further, Bae et al. (2001) demonstrate that response to metal combinations is dose-dependent. Finally, other elements present in water such as Ca may interact with dissolved metals and modulate the biological effect. Therefore, Ca determination was assessed in water samples using ICP–OES. As illustrated in Table 1, a wide range of Ca contents (0.6–5.7 mM) was observed among the 10 water samples. Closer examination (Fig. 2) reveals that four samples with the lowest Ca concentrations (range of 0.6–1.8 mM) induced MT-2A gene expression whereas five samples with higher concentrations (range of 1.9–5.7 mM) did not. Only Sample 7 did not verify this observation since it strongly induced MT-2A gene expression despite a high Ca concentration (5.4 mM). When excluding this outlier from calculation, the correlation coefficient between Ca and MT-2A gene expression was r = –0.62. At the present time, we do not have a clear explanation for the apparent inverse relationship between Ca concentration and MT-2A gene induction. Several reports have demonstrated that Ca concentration is inversely correlated with metal toxicity, affecting metal uptake or metal-dependent cellular events (Gill and Epple, 1992; Guven et al., 1995; Larison et al., 2000; Naddy et al., 2002). Thus, it may be that Ca interferes with low concentrations of metal mixtures present in water. It is also conceivable that Ca affects directly or indirectly MT-2A gene induction pathways. Clearly, more investigations on additional water samplings as well as in vitro studies using, for instance, mixtures broadly comparable with those found in field water samples may help to clarify this issue.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 2. Representation of metallothionein-2A (MT-2A) gene expression by CEM-C12 (as pictured in Fig. 1C) versus Ca concentration measured in water samples. Numbers close to each dot represent number of water samples. Sample 7, which is considered as an outlier in this series of points, is represented by an empty dot.

 

    CONCLUSIONS
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
This report indicates that MT-2A gene expression in human T cells is a useful tool, complementary to physicochemical analysis, to assess the impacts of environmental metal elements in water. Moreover, compared with the use of freshwater organisms, the cultured cell system appears sufficiently sensitive for the detection of biological effects in the absence of a casual pollution, and gets rid of natural variations independent of environmental factors. This study also points out the need for further research to fully appreciate the biological potential of mixtures of concern in runoff water. We anticipate that long-term integration of our ongoing laboratory and field studies will allow us to evaluate, at different scales and levels, whether metal elements can be transferred from sludge-treated soil via runoff to surface waters.


    ACKNOWLEDGMENTS
 
We would like to thank G. Chêne for technical assistance for field water sampling; Y. Richard, J. Bernard, P. Pech, and J. Deschatrette for helpful advice and discussions; and P. Audesse (IRDA) for chemical measurements and methodological information. We are also indebted to M. Hadchouel, M. Schumacher, and their staff (INSERM U347 and U488) for support and laboratory space.


    NOTES
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 
This study was in part supported by l'Agence de l'Environnement et de la Maîtrise de l'Energie (ADEME, Grant no. 0075012).


    REFERENCES
 TOP
 NOTES
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS AND DISCUSSION
 CONCLUSIONS
 REFERENCES
 





This Article
Right arrow Abstract Freely available
Right arrow Figures Only
Right arrow Full Text (PDF) Free
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via Web of Science (1)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Quilbé, R.
Right arrow Articles by Oudinet, J.-P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Quilbé, R.
Right arrow Articles by Oudinet, J.-P.
Agricola
Right arrow Articles by Quilbé, R.
Right arrow Articles by Oudinet, J.-P.
Related Collections
Right arrow Runoff
Right arrow Heavy Metals
Right arrow Experiment Design
Right arrow Cell Biology & Molecular Genetics
Right arrow Water Pollution


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
The SCI Journals Agronomy Journal Crop Science
Journal of Natural Resources
and Life Sciences Education
Vadose Zone Journal
Soil Science Society of America Journal Journal of Plant Registrations The Plant Genome